ID: 1100414352_1100414360

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1100414352 1100414360
Species Human (GRCh38) Human (GRCh38)
Location 12:94356338-94356360 12:94356390-94356412
Sequence CCAGCTAAAGCTAAAGCGGCAAA CACCCCCTCATTATTTTTTGAGG
Strand - +
Off-target summary {0: 33, 1: 95, 2: 28, 3: 19, 4: 75} {0: 1, 1: 0, 2: 0, 3: 27, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!