ID: 1100501980_1100501988

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1100501980 1100501988
Species Human (GRCh38) Human (GRCh38)
Location 12:95183166-95183188 12:95183200-95183222
Sequence CCACTATGCTTCTGCTGATAAAG CCCTCTTAGTCACAAGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 217} {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!