ID: 1100581499_1100581505

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1100581499 1100581505
Species Human (GRCh38) Human (GRCh38)
Location 12:95943740-95943762 12:95943782-95943804
Sequence CCCATTGGAACGCATCAGGGTCC TCACTGTCCAACCATCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36} {0: 1, 1: 0, 2: 1, 3: 22, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!