ID: 1100588302_1100588309

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1100588302 1100588309
Species Human (GRCh38) Human (GRCh38)
Location 12:95999724-95999746 12:95999767-95999789
Sequence CCTGTACAACGTGGACTAGAGAG CACTGACGGTGCTGCAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39} {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!