ID: 1100613079_1100613089

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1100613079 1100613089
Species Human (GRCh38) Human (GRCh38)
Location 12:96208450-96208472 12:96208501-96208523
Sequence CCTGAGAAGAGCATGCAATGGCG CTTTCTGTGAAGGAGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 76, 4: 5769} {0: 1, 1: 0, 2: 2, 3: 28, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!