ID: 1100618399_1100618413

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1100618399 1100618413
Species Human (GRCh38) Human (GRCh38)
Location 12:96249335-96249357 12:96249385-96249407
Sequence CCAGGATTTCATGACAGCTCAAG CTGCGGAGGGGGAGGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136} {0: 1, 1: 0, 2: 12, 3: 74, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!