|
Left Crispr |
Right Crispr |
Crispr ID |
1100647954 |
1100647963 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:96551145-96551167
|
12:96551183-96551205
|
Sequence |
CCTGTAGTCCTAGCTACTTGGGA |
GGGAAATCAAGGCTGCAGTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2484, 1: 49947, 2: 165173, 3: 227638, 4: 248383} |
{0: 3, 1: 14, 2: 111, 3: 328, 4: 898} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|