ID: 1100647954_1100647963

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1100647954 1100647963
Species Human (GRCh38) Human (GRCh38)
Location 12:96551145-96551167 12:96551183-96551205
Sequence CCTGTAGTCCTAGCTACTTGGGA GGGAAATCAAGGCTGCAGTGAGG
Strand - +
Off-target summary {0: 2484, 1: 49947, 2: 165173, 3: 227638, 4: 248383} {0: 3, 1: 14, 2: 111, 3: 328, 4: 898}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!