ID: 1100876803_1100876805

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1100876803 1100876805
Species Human (GRCh38) Human (GRCh38)
Location 12:98970740-98970762 12:98970760-98970782
Sequence CCTTCTCCATGCGACTAATGATC ATCTGTTACTACTTCCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55} {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!