ID: 1100935634_1100935637

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1100935634 1100935637
Species Human (GRCh38) Human (GRCh38)
Location 12:99661899-99661921 12:99661917-99661939
Sequence CCTTCCTCTTCCTGCTGATTGAA TTGAATGCTAATGAAATAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 480} {0: 1, 1: 0, 2: 1, 3: 39, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!