ID: 1100990684_1100990690

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1100990684 1100990690
Species Human (GRCh38) Human (GRCh38)
Location 12:100248261-100248283 12:100248306-100248328
Sequence CCATTTCGTAGTTGAGGAAACTG TTGCCCAGACAATTTGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 165, 3: 1299, 4: 5436} {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!