ID: 1100993149_1100993152

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1100993149 1100993152
Species Human (GRCh38) Human (GRCh38)
Location 12:100272008-100272030 12:100272053-100272075
Sequence CCAGGTGCACGTAAAATCTAGTA TTCTATTGAAAGCCAGGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44} {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!