ID: 1101045738_1101045743

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1101045738 1101045743
Species Human (GRCh38) Human (GRCh38)
Location 12:100803930-100803952 12:100803977-100803999
Sequence CCCCTTAGCAGAGCTTTTTTTTT CGGTAATGTGCAGGATGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 98, 4: 1084} {0: 1, 1: 0, 2: 6, 3: 54, 4: 1371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!