ID: 1101094085_1101094096

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1101094085 1101094096
Species Human (GRCh38) Human (GRCh38)
Location 12:101318075-101318097 12:101318119-101318141
Sequence CCTTCCACCCACCTTCCCCACCA CCTTTTAACTTGCCTTCTACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 25, 3: 268, 4: 2539} {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!