ID: 1101122487_1101122496

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1101122487 1101122496
Species Human (GRCh38) Human (GRCh38)
Location 12:101597492-101597514 12:101597545-101597567
Sequence CCTACCGTGGCCTAATTCTGGGA TCTTCTAAGGAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65} {0: 1, 1: 0, 2: 4, 3: 43, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!