ID: 1101145858_1101145875

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1101145858 1101145875
Species Human (GRCh38) Human (GRCh38)
Location 12:101839837-101839859 12:101839887-101839909
Sequence CCAAATAAATAAATATTTTTAAA ATGGAAAGAGTTGGGGCGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 32, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!