ID: 1101168556_1101168560

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1101168556 1101168560
Species Human (GRCh38) Human (GRCh38)
Location 12:102063879-102063901 12:102063905-102063927
Sequence CCCAGACCTTACATTGGAAGCCA TAGCTGAAGCAGAGTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118} {0: 1, 1: 4, 2: 36, 3: 175, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!