ID: 1101241597_1101241601

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1101241597 1101241601
Species Human (GRCh38) Human (GRCh38)
Location 12:102844632-102844654 12:102844647-102844669
Sequence CCACCCAATGGGCTGGAATCCCA GAATCCCAGATGGAAGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 664, 4: 23050} {0: 1, 1: 0, 2: 4, 3: 39, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!