ID: 1101281896_1101281898

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1101281896 1101281898
Species Human (GRCh38) Human (GRCh38)
Location 12:103266289-103266311 12:103266316-103266338
Sequence CCAAGACTGGTTGTATTTATATC TCTTTATTTTAGAAAGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161} {0: 1, 1: 0, 2: 5, 3: 46, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!