ID: 1101330203_1101330205

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101330203 1101330205
Species Human (GRCh38) Human (GRCh38)
Location 12:103751324-103751346 12:103751344-103751366
Sequence CCATGAGGAAGACACATGAAGGC GGCTGTGACCCCCTAGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 211} {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!