ID: 1101331009_1101331016

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1101331009 1101331016
Species Human (GRCh38) Human (GRCh38)
Location 12:103757972-103757994 12:103758020-103758042
Sequence CCATAGGATTCACTGAGGAAAGG GCAGGCAGAAGACACAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156} {0: 1, 1: 0, 2: 6, 3: 70, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!