ID: 1101340906_1101340919

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1101340906 1101340919
Species Human (GRCh38) Human (GRCh38)
Location 12:103841236-103841258 12:103841286-103841308
Sequence CCCTGCAGGAGGGCAGCTCCTGC CCCTCCCGCCGCTGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 352} {0: 1, 1: 1, 2: 4, 3: 42, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!