ID: 1101361292_1101361298

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1101361292 1101361298
Species Human (GRCh38) Human (GRCh38)
Location 12:104030010-104030032 12:104030041-104030063
Sequence CCGCAAAAGCCCCCAAATAACTG TTGAGCAGGAACAAAACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 470} {0: 1, 1: 2, 2: 6, 3: 46, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!