ID: 1101366919_1101366923

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1101366919 1101366923
Species Human (GRCh38) Human (GRCh38)
Location 12:104081053-104081075 12:104081068-104081090
Sequence CCTGCCCAGTGTAGGCTTTATGT CTTTATGTAAGTGTTAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101} {0: 1, 1: 0, 2: 0, 3: 3, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!