ID: 1101419169_1101419183

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101419169 1101419183
Species Human (GRCh38) Human (GRCh38)
Location 12:104535207-104535229 12:104535256-104535278
Sequence CCGTCCTTGATATTCTCATAGAG GTGGAAGGAATGGGAATGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184} {0: 1, 1: 0, 2: 7, 3: 46, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!