ID: 1101422891_1101422893

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1101422891 1101422893
Species Human (GRCh38) Human (GRCh38)
Location 12:104563995-104564017 12:104564012-104564034
Sequence CCTGGGACAGTTATTTGAGATCT AGATCTACGTGGAGACACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156} {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!