ID: 1101612593_1101612598

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1101612593 1101612598
Species Human (GRCh38) Human (GRCh38)
Location 12:106304595-106304617 12:106304637-106304659
Sequence CCTTCCCTTTACTACACATATGT TGACCTCGATCTAGTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 195} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!