ID: 1101642115_1101642123

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101642115 1101642123
Species Human (GRCh38) Human (GRCh38)
Location 12:106594542-106594564 12:106594574-106594596
Sequence CCCAGGCTGCGGGGCATTCTCGC CTCACAGGGCACAGCTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 206} {0: 1, 1: 0, 2: 2, 3: 31, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!