|
Left Crispr |
Right Crispr |
| Crispr ID |
1101746703 |
1101746714 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:107547162-107547184
|
12:107547204-107547226
|
| Sequence |
CCAACCTGGGTCACAAAGTAAGA |
GAGAAGAAGGAGAAGGGGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 727, 3: 12972, 4: 102629} |
{0: 1, 1: 8, 2: 113, 3: 871, 4: 4673} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|