ID: 1101759348_1101759356

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1101759348 1101759356
Species Human (GRCh38) Human (GRCh38)
Location 12:107646093-107646115 12:107646123-107646145
Sequence CCGGACGCAGCTGAGGCTGCACC GGGGGCCTCCGCGAAGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 240} {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!