ID: 1101774150_1101774165

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1101774150 1101774165
Species Human (GRCh38) Human (GRCh38)
Location 12:107778539-107778561 12:107778567-107778589
Sequence CCCCATCCCACCCCACCCCACCC GTGCAAAGCAGGAGCTGCGTTGG
Strand - +
Off-target summary {0: 5, 1: 166, 2: 292, 3: 1085, 4: 4577} {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!