ID: 1101817125_1101817134

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1101817125 1101817134
Species Human (GRCh38) Human (GRCh38)
Location 12:108153773-108153795 12:108153817-108153839
Sequence CCTGCCAGGGCCTCCCGTTGGCC AAGCAGAAAGCTCATTGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 56, 4: 390} {0: 1, 1: 0, 2: 1, 3: 21, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!