ID: 1101853806_1101853816

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1101853806 1101853816
Species Human (GRCh38) Human (GRCh38)
Location 12:108425613-108425635 12:108425661-108425683
Sequence CCAGCCTCAGCCTGATCCCACAT ACACATTAGGTCCCACCTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!