ID: 1101910418_1101910431

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101910418 1101910431
Species Human (GRCh38) Human (GRCh38)
Location 12:108857179-108857201 12:108857225-108857247
Sequence CCCTGCAAAGTCGCCCCCCGATA CCCGCACAGCTCCCCAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18} {0: 1, 1: 0, 2: 1, 3: 19, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!