ID: 1101910462_1101910477

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1101910462 1101910477
Species Human (GRCh38) Human (GRCh38)
Location 12:108857339-108857361 12:108857370-108857392
Sequence CCCCCTGCCCCGCACGCGCGGCC GGCGGCCTCGGCGCGGCGTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 380} {0: 1, 1: 0, 2: 1, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!