ID: 1101910479_1101910489

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1101910479 1101910489
Species Human (GRCh38) Human (GRCh38)
Location 12:108857375-108857397 12:108857400-108857422
Sequence CCTCGGCGCGGCGTCCGGCGGCC GGCCGGGCGCGGCGAGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 175} {0: 1, 1: 0, 2: 5, 3: 52, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!