ID: 1101919286_1101919297

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1101919286 1101919297
Species Human (GRCh38) Human (GRCh38)
Location 12:108919390-108919412 12:108919426-108919448
Sequence CCCACACCTGGGCCTGCACCCAC CCCACACCTGTGCCCACACTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 11, 3: 49, 4: 435} {0: 1, 1: 0, 2: 3, 3: 49, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!