ID: 1101919293_1101919297

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1101919293 1101919297
Species Human (GRCh38) Human (GRCh38)
Location 12:108919409-108919431 12:108919426-108919448
Sequence CCACACCTGGGCCTATACCCACA CCCACACCTGTGCCCACACTTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 55, 4: 464} {0: 1, 1: 0, 2: 3, 3: 49, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!