ID: 1101970543_1101970546

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1101970543 1101970546
Species Human (GRCh38) Human (GRCh38)
Location 12:109309450-109309472 12:109309486-109309508
Sequence CCCTCTTCAAACTTTGCCAACAG ATGCCCGAGAGCATGCGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 250} {0: 1, 1: 0, 2: 0, 3: 12, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!