ID: 1101988042_1101988050

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1101988042 1101988050
Species Human (GRCh38) Human (GRCh38)
Location 12:109462582-109462604 12:109462606-109462628
Sequence CCAGTAAGCACAATAAATGAGTG AGCTGGGCGGGGCTGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} {0: 1, 1: 0, 2: 8, 3: 95, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!