ID: 1101988122_1101988126

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1101988122 1101988126
Species Human (GRCh38) Human (GRCh38)
Location 12:109463164-109463186 12:109463187-109463209
Sequence CCTTCCACGTTCTGCCTTTGATG TCTGCAGAACTCAGCTGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 102, 4: 208} {0: 1, 1: 0, 2: 0, 3: 23, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!