ID: 1101996289_1101996295

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1101996289 1101996295
Species Human (GRCh38) Human (GRCh38)
Location 12:109527629-109527651 12:109527654-109527676
Sequence CCGGCCTTGCTCCTTGGCCACAG CATTAGTTTGAAAACTTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 353} {0: 1, 1: 0, 2: 2, 3: 22, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!