ID: 1102006984_1102006996

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1102006984 1102006996
Species Human (GRCh38) Human (GRCh38)
Location 12:109595415-109595437 12:109595466-109595488
Sequence CCTGGTGCAGGGCTGGGCTGTGG CACAAGCTTGGGAAGTAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 99, 4: 684} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!