ID: 1102035165_1102035172

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1102035165 1102035172
Species Human (GRCh38) Human (GRCh38)
Location 12:109766793-109766815 12:109766823-109766845
Sequence CCCGAAGCCGGGCAGGGGCATCT GACCTAGAAATTCCATTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157} {0: 1, 1: 31, 2: 308, 3: 2067, 4: 10928}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!