ID: 1102038564_1102038572

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1102038564 1102038572
Species Human (GRCh38) Human (GRCh38)
Location 12:109786281-109786303 12:109786318-109786340
Sequence CCTCAGCTTCCCATTTCACCGAG CCCCACTGTTTGGTAGATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 305} {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!