ID: 1102087054_1102087059

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1102087054 1102087059
Species Human (GRCh38) Human (GRCh38)
Location 12:110150334-110150356 12:110150365-110150387
Sequence CCCAAAGTGCTGGAATTACAGGT CCGCACCCGGCCATGTTTTTAGG
Strand - +
Off-target summary {0: 3111, 1: 86006, 2: 313232, 3: 241847, 4: 148165} {0: 1, 1: 1, 2: 4, 3: 24, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!