ID: 1102200636_1102200649

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102200636 1102200649
Species Human (GRCh38) Human (GRCh38)
Location 12:111055575-111055597 12:111055627-111055649
Sequence CCGTCTGCCTCCCTGGAGGGGGC CTCCCGCCTGGCCCCCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 439} {0: 1, 1: 0, 2: 1, 3: 15, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!