ID: 1102212729_1102212735

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1102212729 1102212735
Species Human (GRCh38) Human (GRCh38)
Location 12:111138826-111138848 12:111138862-111138884
Sequence CCGCTTCCCTCAAGTTGGGACTG TTCACCCCACACAGCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 235} {0: 1, 1: 1, 2: 2, 3: 24, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!