ID: 1102227008_1102227018

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1102227008 1102227018
Species Human (GRCh38) Human (GRCh38)
Location 12:111235895-111235917 12:111235948-111235970
Sequence CCATTAGCAGAAGAGGACCTGGC CCAACCTGTGAGATTCAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 128} {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!