ID: 1102235725_1102235735

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102235725 1102235735
Species Human (GRCh38) Human (GRCh38)
Location 12:111293438-111293460 12:111293484-111293506
Sequence CCCTGCAGAGCAGAGAGAGGGGA ACCGAGGGAAGCCGCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 428} {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!