ID: 1102236749_1102236755

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1102236749 1102236755
Species Human (GRCh38) Human (GRCh38)
Location 12:111298556-111298578 12:111298594-111298616
Sequence CCTGATCATGACCAACCTGGAGA GGAGGCGCAGTTCCCACCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 173} {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!